| dc.creator | Filho, Ruy Brayner de Oliveira | |
| dc.creator | Malta, Karla Campos | |
| dc.creator | Lúcio, Érica Chaves | |
| dc.creator | Nascimento, Glaucia Grazielle | |
| dc.creator | Dutra, Lucas da Costa | |
| dc.creator | Mota, Rinaldo Aparecido | |
| dc.creator | Jr., José Wilton Pinheiro | |
| dc.date | 2018-01-01 | |
| dc.identifier | https://seer.ufrgs.br/index.php/ActaScientiaeVeterinariae/article/view/81811 | |
| dc.description | Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems. | en-US |
| dc.format | application/pdf | |
| dc.language | eng | |
| dc.publisher | Universidade Federal do Rio Grande do Sul | en-US |
| dc.relation | https://seer.ufrgs.br/index.php/ActaScientiaeVeterinariae/article/view/81811/48974 | |
| dc.rights | Copyright (c) 2018 Ruy Brayner de Oliveira Filho, Karla Campos Malta, Érica Chaves Lúcio, Glaucia Grazielle Nascimento, Lucas da Costa Dutra, Rinaldo Aparecido Mota, José Wilton Pinheiro Jr. | pt-BR |
| dc.source | Acta Scientiae Veterinariae; Vol. 46 (2018): ARTICLES; 7 | en-US |
| dc.source | Acta Scientiae Veterinariae; v. 46 (2018): ARTICLES; 7 | pt-BR |
| dc.source | 1679-9216 | |
| dc.title | Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil | en-US |
| dc.type | info:eu-repo/semantics/article | |
| dc.type | info:eu-repo/semantics/publishedVersion | |
