| dc.creator | Bechara I.J. | |
| dc.creator | Destefano R.H.R. | |
| dc.creator | Bresil C. | |
| dc.creator | Messias CL. | |
| dc.date | 2011 | |
| dc.date | 2015-06-30T20:18:06Z | |
| dc.date | 2015-11-26T14:47:45Z | |
| dc.date | 2015-06-30T20:18:06Z | |
| dc.date | 2015-11-26T14:47:45Z | |
| dc.date.accessioned | 2018-03-28T21:58:21Z | |
| dc.date.available | 2018-03-28T21:58:21Z | |
| dc.identifier | | |
| dc.identifier | Brazilian Journal Of Biology. , v. 71, n. 1, p. 91 - 98, 2011. | |
| dc.identifier | 15196984 | |
| dc.identifier | 10.1590/S1519-69842011000100014 | |
| dc.identifier | http://www.scopus.com/inward/record.url?eid=2-s2.0-79953201914&partnerID=40&md5=e78671d93d500e7da59b282048a9354a | |
| dc.identifier | http://www.repositorio.unicamp.br/handle/REPOSIP/107496 | |
| dc.identifier | http://repositorio.unicamp.br/jspui/handle/REPOSIP/107496 | |
| dc.identifier | 2-s2.0-79953201914 | |
| dc.identifier.uri | http://repositorioslatinoamericanos.uchile.cl/handle/2250/1253404 | |
| dc.description | The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects. | |
| dc.description | 71 | |
| dc.description | 1 | |
| dc.description | 91 | |
| dc.description | 98 | |
| dc.description | Bartnicki-Garcia, S., Nickerson, W.J., Induction of yeastlike development in Mucor by carbon dioxide (1962) Journal of Bacteriology, 84 (4), pp. 829-840 | |
| dc.description | Bartnicki-Garcia, S., Lippman, E., The bursting tendency of hyphal tips of fungi: Presumptive evidence for delicate balance between wall synthesis and wall lysis in apical growth (1972) Journal of General Microbiology, 73, pp. 487-500 | |
| dc.description | Brown, R.G., (1965) Biochemistry of morphogenesis in black yeast-like fungi, , PhD thesis, Rutgers University | |
| dc.description | Carneiro, R.M.D.G., Salles, L.A.B., Patogenicidade de Paecilomyces fumoroseus, isolado CG 260 sobre larvas e pupas de Anastrepha fraterculus Wied (1994) Anais da Sociedade Entomológica do Brasil, 23 (2), pp. 341-343 | |
| dc.description | Destéfano, R.H.R., Destéfano, S.A.L., Messias, C.L., Detection of Metarhizium anisopliae var. anisopiae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers (2004) Genetics and Molecular Biology, 27 (2), pp. 245-252 | |
| dc.description | Destéfano, R.H.R., Bechara, I.J., Messias, C.L., Ferraz Filho, A.N., Piedrabuena, A.E., Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera: Tephritidae) (2005) Brazilian Journal of Microbiology, 36 (1), pp. 94-99 | |
| dc.description | Garcia, A.T.S., Messias, C.L., Souza, H.M.L., Piedrabuena, A.E., Patogenicidade de Metarhizium anisopliae a Ceratitis capitata (Wied) (Diptera, Tephritidae) (1984) Revista Brasileira de Entomologia, 28 (4), pp. 421-424 | |
| dc.description | Garcia, A.T.S., Baracho, I.R., Souza, H.M.L., Messias, C.L., Virulência de linhagens mutantes e Diplódies de Metarhizium anisopliae em Ceratitis capitata (Wied) (Diptera, Tephritidae) (1985) Revista Brasileira de Entomologia, 29 (2), pp. 267-270 | |
| dc.description | Greany, P.D., McDonald, R.E., Schroeder, W.J., Shaw, P.E., Improvements in efficacy of gibberelic acid treatment in reducing susceptibility of grapefruit to attack by Caribbean fruit fly (1991) Florida Entomologist, 74 (4), pp. 570-580 | |
| dc.description | Kleespies, R.G., Zimmermann, G., Production of blastospore by three strains of Metarhizium anisopliae (Metch) Sorokin in submerged culture (1992) Biocontrol Science and Technology, 2 (2), pp. 127-135 | |
| dc.description | Leite, L.G., Alves, S.B., Pereira, R.M., Insecticidas Microbianos (2003) Bases para el manejo racional de inseticidas, pp. 113-156. , In AGUAYO, G.S. | |
| dc.description | GALLO, R. H (Eds.), Chillán: Trama Impressores | |
| dc.description | Magalhães, B.P., Butt, T.M., Shield, E.J., Humber, R.A., Roberts, D.W., Formation of Apressoria in vitro by the entomopathogenic fungi Zoopththora radicans (Zygomycetes: Entomophthorales) (1990) Journal of Invertebrate Pathology, 55 (2), pp. 284-288 | |
| dc.description | Marmaras, V.J., Charalambidis, N., Certain hemocyte proteins of the medfly, Ceratitis capita, are responsible for nonself recognition and Immobilization of Escherichia coli in vitro (1992) Archives of Insect Biochemistry and Physiology, 21 (4), pp. 281-288 | |
| dc.description | Marmaras, V.J., Bournazos, S.N., Katsoris, P.G., Lambropoulou, M., Defesense mechanisms in insects: Certain integumental proteins and tyrosinase are responsible for nonself-recognition and immobilization of Escherichia coli in the cuticle of developing Ceratitis capitata (1993) Archives of Insect Biochemistry and Physiology, 23 (4), pp. 169-180 | |
| dc.description | Messias, C.L., Pupin, A.M., The cuticular components from Diatrae saccharalis, and their effect on in vitro growth of Metarhizium anisopliae (1990) Fifth Colloquium on Invertebrate Pathology and Microbial Control, p. 315. , In, Adelaide, Australia | |
| dc.description | Messias, C.L., Utilização de fungos entomopatogênicos para o controle biológico das pragas agrícolas (1992) II Ciclo de Palestras sobre controle biológico de pragas, pp. 111-125. , In CRUZ, B.P. B, BATISTA FILHO, A and LEITE GARRIGÓS, L. (Eds.), Campinas: Fundação Cargil | |
| dc.description | Morgante, J.S., (1991) Moscas-das-frutas (Tephritidae): Características biológicas, detecção e controle, 2, p. 19. , Brasília: SENIR, Boletim Técnico | |
| dc.description | Nascimento, A.S., Morgante, J.S., Malavasi, A., Uramoto, K., Occurence and distribution of Anastrepha in melon production áreas in Brazil (1993) Fruit flies: Biology and management, pp. 39-42. , In ALUJA, M. and LIEDO, P. (Eds.), New York: Springer-Verlag. p. 492 | |
| dc.description | Oliveira, N.T., Messias, C.L., Variability of strains of Metarhizium anisopliae var. anisopliae (Metsch.) Sorokin in terms of protein content and spore germination (1996) Revista de Microbiologia, 27, pp. 268-272 | |
| dc.description | Orlando, A., Sampaio, A.S., Moscas-das-frutas. Notas sobre o reconhecimento e combate (1973) O Biológico, 39 (6), pp. 143-150 | |
| dc.description | Orlowski, M., Mucor dimorphism. 1991 (1991) Microbiology and Molecular Biology Reviews, 55 (2), pp. 234-258 | |
| dc.description | Pekrul, S., Grula, E.A., Mode of infection of the corn carworm (Heliothis zea) by Beauveria bassiana as revealed by scanining electron microscopy (1979) Journal of Invertebrate Pathology, 34, pp. 238-247 | |
| dc.description | Pontecorvo, G., Roper, J.A., Hemmons, L.M., McDonald, K.F., Buffon, A.W.J., The genetics of Aspergillus nidulans (1953) Advances in Genetics, 5 (1), pp. 41-238 | |
| dc.description | Pria Jr., W.D., Lacava, P.T., Messias, C.L., Azevedo, J.L., Lacava, P.M., Bosassay Assessment of Metarhizum anisopliae (Metachnikoff) Sorokin (Deuteromycota:Hyphomycetes) Against Oncometopia facialis (Signoret) (Hemiptera:Cicadelllidae) (2008) Brazilian Journal of Microbiology, 39 (1), pp. 128-132 | |
| dc.description | Schneider, D.R.S., (2002) Análise Morfoepigenética de linhagens selvagens e mutantes de Metarhizium anisopliae var. anisopliae, p. 189. , Campinas: Universidade Estadual de Campinas, Dissertação de Mestrado em Genética e Biologia Molecular | |
| dc.description | Silveira, J.A., Messias, C.L., Infecção de Deois sp. Metarhizium anisopliae, penetração e colonização (1982) Ciência e Cultura, 34, p. 760 | |
| dc.description | St Leger, R.J., Butt, T.M., Goettel, M.S., Staples, R.C., Roberts, D.W., Production in vitro of appressoria by the entomopathogenic fungus Metarhizium anisopliae (1989) Experimental Mycology, 13. , 274-228 | |
| dc.description | St Leger, R.J., Goettel, M., Roberts, D.W., Staples, R.C., Pre-penetration events during infection of host cuticle by Metarhizium anisopliae (1991) Journal of Invertebrate Pathology, 58, pp. 168-179 | |
| dc.description | St Leger, R.J., Biology and mechasnisms of insect-cuticle invasion by deuteromycete fungal pathogens (1993) Parasites and phathogens of insects, 2, pp. 211-229. , In, Pathogens. Los Angeles: Academic Press | |
| dc.description | Szaniszlo, P.J., Kang, M.S., Cabib, E., Stimulation of ß (1-3) glucan synthetase of various fungi by nucleoside triphosphates. A generalized regulatory mechanism for cell wall biosynthesis (1985) Journal of Bacteriology, 161 (3), pp. 1188-1194 | |
| dc.description | Wang, Q., Szaniszlo, P.J., WdStuAp, an APSES transcription factor, is a regulator of yeast-hyphal transitions in Wangiella (Exophiala) dermatitidis (2007) Eukaryotic Cell, 6 (9), pp. 1595-1605 | |
| dc.description | Zacharuck, R.Y., Fine structure of the fungus Metarhizium anisopliae infecting three species of larval elateridae (Coleoptera) I. Dormant and germinating conidia (1970) Journal of Invertebrate Pathology, 15, pp. 63-80 | |
| dc.description | Zacharuck, R.Y., Fine structure of the fungus Metarhizium anisopliae infecting three species of larval elateridae (Coleoptera). II. Conidial germ tubes and apressoria (1970) Journal of Invertebrate Pathology, 15, pp. 81-91 | |
| dc.language | pt | |
| dc.publisher | | |
| dc.relation | Brazilian Journal of Biology | |
| dc.rights | aberto | |
| dc.source | Scopus | |
| dc.title | Histopathological Events And Detection Of Metarhizium Anisopliae Using Specific Primers In Infected Immature Stages Of The Fruit Fly Anastrepha Fraterculus (wiedemann, 1830) (diptera: Tephritidae) [eventos Histológicos E Detecção De Metarhizium Anisopliae Usando Primers Específicos Em Estágios Imaturos Da Mosca Das Frutas Anastrepha Fraterculus (wiedemann, 1830) (diptera: Tephritidae)] | |
| dc.type | Artículos de revistas | |